Clone

Target
IDP01169  
Clone Suffix
102
Experiment Start Date
Mar 02, 2012  
Experiment End Date
Mar 02, 2012  
Person
Jerzy Osipiuk  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG68  
Sequence Start
1  
Sequence End
475  
Reference Sequence Used
MLTPISIEKE HIRLINLLHF INEQNRWFTI KELSDYLQVA DKTVRKYLKL LEDEIPPSWN LLVQKGKGIY LKKPLNESLS FVESKILRKS LNLQICEELV FKKNSMQSLA QKLHLQVGAL YPIINQINYD IQSSHLNIKK KPLEISGREQ DVRVFMLRLY CNIPNDYWPF PYINKQNITD LINKMEKILN VQMYTYSKHK LCVLFAITIS RLLSGNTIDN VSGLILVNKN DDHYKTVASI TSELQNSFGV TLHETEISFL ALALLLSLGN SITTDSNKTL TSYKKTIMPL AKEITKGIEH KLQLGINYDE SFLTYVVLII KKALDKNFIQ YYNYNIKFIR HIKQRHPNTF NTIQECISNL NYTVYSHFDC YEISLLTMHF ETQRMLFKNN PKKIYVYTSQ GCIHREYISA LLEKRYNGLI KIVRNTIINL TNESLQDMEI DIIISNVNLP IKNIPIVQIS EFPTERDFHE IKKII  
PCR Forward Primer
TACTTCCAATCCAATGCCATGCTAACACCGATATCCATCGAAAAGG  
PCR Backward Primer
TTATCCACTTCCAATGTTATATTATCTTTTTGATTTCATGAAAATCTCTTTCTGTAGGA  
Shipped To Lab
ANL  
Shipped Date
Mar 02, 2012  
Inserted
Jun 05, 2013