Clone

Target
IDP00055  
Clone Suffix
2
Experiment Start Date
Apr 21, 2008  
Experiment End Date
Apr 22, 2008  
Person
Jason Stam  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG19c  
Sequence Start
1  
Sequence End
142  
Reference Sequence Used
MNIEQQLYDV VKQLIEQRYP NDWGGAAAIR VEDGTIYTSV APDVINASTE LCMETGAILE AHKFQKKVTH SICLARENEH SELKVLSPCG VCQERLFYWG PEVQCAITNA KQDIIFKPLK ELQPYHWTEA YHDEMVKEWS TR  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGAATATTGAGCAACAATTATATG  
PCR Backward Primer
TTATCCACTTCCAATGCTATCTCGTACTCCATTCTTTT