Clone

Target
IDP00005  
Clone Suffix
1
Experiment Start Date
Apr 21, 2008  
Experiment End Date
Apr 22, 2008  
Person
Jason Stam  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
1070  
Reference Sequence Used
MLVAATLSLP FAVYATPILA ATAATENMAV QSPKKHVFDA VIKAYKDNSD EESYATVYIK DPKLTIENGK RIITATLKDS DFFDYLKVED SKEPGVFHDV KVLSEDKRKH GTKVIQFEVG ELGKRYNMQM HILIPTLGYD KEFKIQFEVN MRTFVESDIE EDEEEQIEDT QNIIRDKRLQ QAINKNVLNR KDVNEPIFEE DLKEIKELNI YAGQGIESLK GLEYMENLER ITIQGSDVRN IAPISQLKRL KVVDLSFNKI ENVEPLVNLE KLDILELQNN RIADVTPLSQ LKKVRTINLS GNKISDIKPL YNVSSLRKLY VSNNKITDFT GIEQLNKLGT LGVGSNGLVN IEPISQMSGI VELNLEKNDI KDITSLSKLT GLQSLNLEEN YVSDVSSLSN LINLYELKLA TNEIRDIRPI QELGKRIKID AQRQKVFLDE AYMNEEVKIP VYDVNGTALQ NIEWKSEGGS ITNGVIKWNS LGEKMYEFKM DAGESKIRFQ GRVIQNIVEK REESSNVIQD MKLRQYMNKH NFERKNVNTP ITKEDLLTVK ALKITDGKKE GITDFSGLEF MTNVEELTLQ NVNMKNAEFI SSLRNLKSVD LSYNQIEDIK PLHSLEDLEK LNVSDNGIKN VPELFKMQKL KTLDLSNNKL DNAALDGIHQ LENLDALLVN NNEINNLDEI SKVSKLNKLE MMSNKVRDIS PLASLKNLQW LNLSDNKIQD ISTLSSMLDL LSLKLAGNEI RDVRPVIQLA QWITVDIKNQ KIVLEDGQMN QEIQIPIYDL EGEIFEDIEL KSTDGIVTDR GTVVWKTPGA KIYSFSLNGN YHGLSLLFSG TVTQNIVAKE EPKEPVEEVE GSKEEPIKEA EGSKEEPKEP AKEVEGSKEE PKEPAKEVEG SKEEVKEPAK EVEGPKEEVK EPTKEVEGPK EEVKEPTKEV EGPKEEVKEP MKEVEGSKEE VKGPTKEAEG SKEEVKEPTT EVEGSKEVKE PGKEVEGSKD AINQSAVAQE TNVNNQVGKE KVVENQNMKE NKPAVTKQEE SKKSLGATGG QENTSTLLSG LALVLSALSM FVFRKRLFKK  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGTTAGTGGCTGCGACATTA  
PCR Backward Primer
TTATCCACTTCCAATGTTATTTCTTAAATAATCTCTTTCTAA