Clone

Target
IDP00023  
Clone Suffix
1
Experiment Start Date
Apr 21, 2008  
Experiment End Date
Apr 22, 2008  
Person
Jason Stam  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
48  
Reference Sequence Used
MKKLLIGSLL TLAMAWGISL GDTALEKNQV ISHNDQEVQL ASDVPFEY  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGAAAAAACTACTTATTGGTAGT  
PCR Backward Primer
TTATCCACTTCCAATGTTAATATTCAAAAGGTACATCTGA