Clone

Target
IDP00034  
Clone Suffix
1
Experiment Start Date
Apr 21, 2008  
Experiment End Date
Apr 22, 2008  
Person
Jason Stam  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
542  
Reference Sequence Used
MFLNTNEILD YSALKYMPNL KSLTVANAKI KDPSFFANLK QLNHLALRGN EFSDVTPLVK MDHLDSLDLS NNKITNVAPL IEMKNVKSLY LSGNQIEDVT ALAKMEQLDY LNLANNKITN VAPLSALKNV TYLTLAGNQI EDIKPLYSLP LTDLVLTRNK VKDLSGIEQM KQLEELWIGK NEIKDVTPLS KMTQLKQLHL PNNELKDITP LSSLVNLQKL DLEANYISDL TPASNLKKLV FLSFVANEIR DVRPVIELSK TAYINVQNQK VFLEETEVNK EVKVPIYEKD GKISTKIRLK GEGGTYSNDA VKWSTPGEKV YEFGVKDPFA DTGIFFTGSV IQNVVESKAD NTSKEDNTSK EDAKVEVVEF KDVPKGHWSE EAIHYLAKEN IFKGYGNGQF GFGDSITRGQ VASLVQRYLK LENKVEQKER FTDTKGHMFE QDIATVAQAG IMQGDGTGEF RPDGVLTRYE MSVVLYKVFQ LKEDGNNKVN FKDVPTGHWA EGYVKALVDN NISKGDGKER FLGDDFVTRE QYAQFLYNAI TK  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGTTTTTAAATACGAATGAGATTC  
PCR Backward Primer
TTATCCACTTCCAATGTTATTTCGTTATTGCGTTATATAAA