Clone

Target
IDP00014  
Clone Suffix
1
Experiment Start Date
Apr 21, 2008  
Experiment End Date
Apr 22, 2008  
Person
Jason Stam  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
343  
Reference Sequence Used
MSDRQAALDM ALKQIEKQFG KGSIMKLGEQ AERKVSTVSS GSLALDVALG VGGYPRGRII EIYGPESSGK TTVSLHAIAE VQRQGGQAAF IDAEHAMDPV YAQKLGVNID ELLLSQPDTG EQGLEIAEAL VRSGAVDIIV IDSVAALVPK AEIEGDMGDS HVGLQARLMS QALRKLSGAI NKSKTIAIFI NQIREKVGVM FGNPETTPGG RALKFYSTVR LEVRRAEQLK QGNDIVGNKT KVKVVKNKVA PPFRVAEVDI MYGEGISREG EILDMASELD IVQKSGAWYS YNEERLGQGR ENSKQFLKEN TDLREEIAFF IREHHGISED SGAEGMEDPN LLD  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGAGTGATCGTCAAGCAGC  
PCR Backward Primer
TTATCCACTTCCAATGTTAATCAAGAAGATTTGGATCTTC  
Shipped To Lab
ANL  
Shipped Date
May 08, 2008  
Inserted
Sep 15, 2008