Clone

Target
IDP00019  
Clone Suffix
1
Experiment Start Date
Apr 21, 2008  
Experiment End Date
Apr 22, 2008  
Person
Jason Stam  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
585  
Reference Sequence Used
MRKTKIVCTI GPASESIEKL EQLIEAGMNV ARLNFSHGSH EEHGARIKNI REASKKTGKT VGILLDTKGP EIRTHDFVDG QAELVTGAEV VLSTEQVLGT AEKFSVSYAG LYDDVDPGSR ILIDDGLIEL EVIEKADGNI RTKVLNSGTV KNKKGVNVPN VSIKLPGITE KDVKDIIFGI EQKVDFIAAS FVRKAADVLE IRELLEEHNA QYIQIVPKIE NQEGIDNIDS ILEVSDGLMV ARGDMGVEIP PEEVPLVQKR LIKKCNVLGK PVITATQMLD SMQRNPRPTR AEASDVANAI FDGTDAIMLS GETAAGQYPV EAVTMMANIA VRVEKSLQYE DMFKKRIKEF TPTITDAISQ SVAHTALALD VAAIVAPTES GYTAKMISKY RPKSPIVAVT SDEQVGRRLA LVWGVQAFMA EKRAASTDEM LDTAIQTGMD AGLIGLGDTV VITAGVPVAE TGTTNLMKIH VVGEEVAKGQ GIGRKAAKGK VVVAKTAAEA VANVNEGDIL VTTSTDKDMI PAIEKAAALV VEEGGLTSHA AVVGVSIGIP VIVGVNGVTA TLKNGQEVTV DAARGIVYNG HAEVL  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGCGTAAAACTAAAATTGTATGT  
PCR Backward Primer
TTATCCACTTCCAATGTTATAGCACTTCCGCATGTCC