Clone

Target
IDP01231  
Clone Suffix
4
Experiment Start Date
Jun 06, 2011  
Experiment End Date
Jun 07, 2011  
Person
Sofiya Shatsman  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
opMCSG28  
Sequence Start
1  
Sequence End
339  
Reference Sequence Used
MFGFGGFTRD LGIDLGTANT LVYVKGKGVV LREPSVVALQ TDTKQIVAVG SDAKQMIGRT PGNVVALRPM KDGVIADYET TATMMKYYIQ QAQKSNGFFS RKPYVMVCVP SGITAVERRA VIDATRQAGA RDAYPIEEPF AAAIGANLPV WEPTGSMVVD IGGGTTEVAI ISLGGIVTSQ SVRVAGDDMD DSIIQYIKKS YNLMIGERTA EALKLEIGSA GEPEGIEPME IRGRDLVSGL PKTVLIQPEE IADALKDTVD AIVESVKNTL EKTPPELAAD IMDRGIVLTG GGALLRNLDK VISEETNMPV LVAEDPLDCV AIGTGKALDN IDLFKTAAR  
Reference Sequence Variance
MATCH  
PCR Forward Primer
GTCTCTCCCATGTTTGGATTTGGTGGCTTTA  
PCR Backward Primer
GGTTCTCCCCACGTCGAGCAGCAGTTTTGAAAAG