Clone

Target
IDP01352  
Clone Suffix
3
Experiment Start Date
Jun 06, 2011  
Experiment End Date
Jun 07, 2011  
Person
Sofiya Shatsman  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
failed  
Vector
opMCSG28  
Sequence Start
1  
Sequence End
230  
Reference Sequence Used
MLGYAFPSIL GNLMSKIYQM DAVDWLKTLE NCSVDLFITD PPYESLEKYR QIGTTTRLKE SKSSSNQWFS VFPNTRFEEL FREVYRVLKK GSHFYLFCDQ ETMFLAKPIA ESVGFKFWKP IVWDKCAIGM GYHYRARYEF ILFFEKGKRK LNDLSVPDVL EYKRVWKGYP TEKPVELLEV LIRQSSSENE IVADSFFGSG STLIAANNLS RKYIGCDISS SAHEYFKNRA  
Reference Sequence Variance
MATCH  
PCR Forward Primer
GTCTCTCCCATGTTAGGTTATGCGTTTCCC  
PCR Backward Primer
GGTTCTCCCCACGAGCTCTATTCTTAAAATACTCATG