Clone

Target
IDP01376  
Clone Suffix
3
Experiment Start Date
Jun 06, 2011  
Experiment End Date
Jun 07, 2011  
Person
Sofiya Shatsman  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
opMCSG28  
Sequence Start
1  
Sequence End
216  
Reference Sequence Used
MKSGWQNFES RFSALSQREK VLITLCGSVL IVMMLLLGLI EPALKQGQAR QLQMQTLTSS NLQLQGEIMA LQAQLAKNPD QELDVELSQL TLQSQEISEL LAAKMTSMVA PSEMPNLLES VLKQGQQLKL VSLESLPAEP IVRATESRSE SEYYIHPVRM ELTGSYFAIR DYLQALEALP VKYYWRHFHY RVESYPQARV ILEVYTLGSR EEFIGG  
Reference Sequence Variance
MATCH  
PCR Forward Primer
GTCTCTCCCATGAAATCGGGTTGGCAAAAC  
PCR Backward Primer
GGTTCTCCCCACGACCACCGATAAACTCCTCTC