Clone

Target
IDP01434  
Clone Suffix
3
Experiment Start Date
Jun 06, 2011  
Experiment End Date
Jun 07, 2011  
Person
Sofiya Shatsman  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
opMCSG28  
Sequence Start
1  
Sequence End
287  
Reference Sequence Used
MEAIDMPYKI TALQPFGVIV EPKHAPIHVN ELDIDELREL FLREQLVLLR GFETFEHSEQ FADYCERWGE VSVWPFGRVL DLVQKEDPGD HIFDSSYMPM HWDGMYRPQV PEYQIFQCVK APLPGHGGRT TFSHTMLALQ HAPQPDLELW QQVTGHYQRK MEFYHSKTVS PIVMQHPYRD YQVIRYNEPH FEENGDLLNP PDVSLSGITP EQAIEFHKSL RRALYDPRNF YAHEWQTGDI VITDNFSLLH GREAFTSHTP RHIRRVQVLS NPPYNNPSLE SYQCPQK  
Reference Sequence Variance
MATCH  
PCR Forward Primer
GTCTCTCCCATGGAGGCCATTGATATGCC  
PCR Backward Primer
GGTTCTCCCCACGTTTTTGTGGACATTGGTACGAC