Clone

Target
IDP01989  
Clone Suffix
2
Experiment Start Date
Jun 06, 2011  
Experiment End Date
Jun 07, 2011  
Person
Sofiya Shatsman  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
opMCSG28  
Sequence Start
1  
Sequence End
127  
Reference Sequence Used
MITGIQITKA ANDDLLNSFW LLDSEKGEAR CIVAKSGFAE DEVVAVSKLG EIEYREIPME VKPEVRVEGG QHLNVNVLRR ETLEDAVKHP EKYPQLTIRV SGYAVRFNSL TPEQQRDVIA RTFTESL  
Reference Sequence Variance
MATCH  
PCR Forward Primer
GTCTCTCCCATGATTACAGGTATCCAGATTAC  
PCR Backward Primer
GGTTCTCCCCACGCAGGCTTTCGGTAAAGGTAC