Clone

Target
IDP00153  
Clone Suffix
1
Experiment Start Date
Apr 21, 2008  
Experiment End Date
Apr 22, 2008  
Person
Jason Stam  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
652  
Reference Sequence Used
MSRFNPSPVS LSVTLGLMFS ASAFAQDATK TDETMVVTAA GYAQVIQNAP ASISVISRED LESRYYRDVT DALKSVPGVT VTGGGDTTDI SIRGMGSNYT LILVDGKRQT SRQTRPNSDG PGIEQGWLPP LQAIERIEVI RGPMSTLYGS DAIGGVINII TRKDQQQWSG NVQLSTVVQE NRASGDEQSA NFFVTGPLSD ALSLQVYGQT TQRDEDEIEH GYGDKSLRSL TSKLNYQLNP DHQLQLEAGV SAQDRENNVG KSAQSSGCRG TCSNTDNQYR RNHVAVSHQG DWQDVGQSDT YLQYEENTNK SREMSIDNTV FKSTLVAPIG EHMLSFGVEG KHESLEDKTS NKISSRTHIS NTQWAGFIED EWALAEQFRL TFGGRLDHDK NYGSHFSPRV YGVWNLDPLW TVKGGVSTGF RAPQLREVTP DWGQVSGGGN IYGNPDLKPE TSINKELSLM YSTGSGLAAS LTAFHNDFKD KITRVACPAN ICTAGPNQWG AAPTYRVNID EAETYGAEAT LSLPITESVE LSSSYTYTHS EQKSGNFAGR PLLQLPKHLF NANLSWQTTD RLNSWANLNY RGKEMQPEGG ASNDDFIAPS YTFIDTGVTY ALTDTATIKA AVYNLFDQEV NYAEYGYVED GRRYWLGLDI AF  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGTCCAGATTCAATCCATCC  
PCR Backward Primer
TTATCCACTTCCAATGTTAGAAGGCGATGTCTAAGCC