Clone

Target
IDP91219  
Clone Suffix
2
Experiment Start Date
Jul 22, 2011  
Experiment End Date
Aug 01, 2011  
Person
Sarah Grimshaw  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
failed  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
840  
Reference Sequence Used
MNQEVKNKIF SILKITFATA LFIFVAITLY RELSGINFKD TLVEFSKINR MSLVLLFIGG GASLVILSMY DVILSRALKM DISLGKVLRV SYIINALNAI VGFGGFIGAG VRAMVYKNYT HDKKKLVHFI SLILISMLTG LSLLSLLIVF HVFDASLILD KITWVRWVLY VVSFFLPLFI IYSMVRPPDK NNRFVGLYCT LVSCVEWLAA AVVLYFCGVI VDAHVSFMSF IAIFIIAALS GLVSFIPGGF GAFDLVVLLG FKTLGVPEEK VLLMLLLYRF AYYFVPVIIA LILSSFEFGT SAKKYIEGSK YFIPAKDVTS FLMSYQKDII AKIPSLSLAI LVFFTSMIFF VNNLTIVYDA LYDGNHLTYY ILLAIHTSAC LLLLLNVVGI YKQSRRAIIF AMISILLITV ATFFTYASYI LITWLAIIFV LLIVAFRRAR RLKRPVRMRN IVAMLLFSLF ILYVNHIFIA GTLYALDIYT IEMHTSVLRY YFWLTILIIA IIIGMIAWLF DYQFSKVRIS SKIEDCEEII NQYGGNYLSH LIYSGDKQFF TNENKTAFLM YRYKASSLVV LGDPLGDENA FDELLEAFYN YAEYLGYDVI FYQVTDQHMP LYHNFGNQFF KLGEEAIIDL TQFSTSGKKR RGFRATLNKF DELNISFEII EPPFSTEFIN ELQHVSDLWL DNRQEMHFSV GEFNEEYLSK APIGVMRNEE NEVIAFCSLM PTYFNDAISV DLIRWLPELD LPLMDGLYLH MLLWSKEQGY TKFNMGMATL SNVGQLHYSY LRERLAGRVF EHFNGLYRFQ GLRRYKSKYN PNWEPRFLVY RKDNSLWESL SKVMRVIRHK  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGAATCAGGAAGTTAAAAACAAA  
PCR Backward Primer
TTATCCACTTCCAATGTTATTTGTGACGTATTACACGC