flash(); ?>

Clone

Target
IDP91415  
Clone Suffix
1
Experiment Start Date
Jul 21, 2011  
Experiment End Date
Jul 21, 2011  
Person
Sofiya Shatsman  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
288  
Reference Sequence Used
VAEQIEFDQA HQALQEVSEA LENGRFVHVR RQLQDMEPED IAHLLEASPR KSREVLWQLT DPEDYGEILD ELSEDVKDSL VSKMAPEDLA EATEGMDTDD VAYVLRSLPD NVSREVLAQM DAADRLRVET ALSYSEDTAG GLMNTDVITI RGDVDVDVVL RYLRMKGELP ENTDALYVID EESRLIGELP ISILITTQPD VKVSEVMEDV DDAIAVTTSD SDVASLFERR NWISAPVIDE NQHLVGRITI DDVVDVIRED AEHSMMSMAG LNDDEDTFAP VVKSARKR  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGGTGGCAGAGCAAATTGAATTC  
PCR Backward Primer
TTATCCACTTCCAATGTCAGCGTTTACGCGCCGAT