flash(); ?>

Clone

Target
IDP91463  
Clone Suffix
1
Experiment Start Date
Jul 22, 2011  
Experiment End Date
Aug 01, 2011  
Person
Sarah Grimshaw  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
159  
Reference Sequence Used
MHTAIVPSPT CVFPQVVHAL YQTLKDYGHN ETVEQHLNKR PGVLLNEINP NQTSHKLGLF DAIKLMQFTG DVQILRSIAS ELNHSIYFLG DYRAISDMEL LNCYSRWHAE IGDVNRAIAD ALEDGDIERH EFDRIERELQ ETFAAALELL ERLRALVNG  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGCATACTGCTATCGTCCC  
PCR Backward Primer
TTATCCACTTCCAATGTTAACCGTTAACCAATGCGCG