Clone

Target
IDP91572  
Clone Suffix
249
Experiment Start Date
Apr 12, 2011  
Experiment End Date
 
Person
Marie-Claude Jobin  
Lab
University of Calgary  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
p15Tv lic  
Sequence Start
61  
Sequence End
213  
Reference Sequence Used
 
PCR Forward Primer
TTGTATTTCCAGGGCAACCAGGATGGTTTATCGAATG  
PCR Backward Primer
CAAGCTTCGTCATCAATTTTTTAAAACGAAGTTACCTCTG