Clone

Target
IDP01032  
Clone Suffix
1
Experiment Start Date
Sep 08, 2008  
Experiment End Date
Sep 09, 2008  
Person
Jason Stam  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
78  
Reference Sequence Used
MASLIQVRDL LALRGRMEAT QISHTLHAPQ PMIDAMLNQL EIMGKAVRIP EEPDGCLSGS CKSCPEGKAC LREWWALR  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGGCTTCATTGATACAGGTTC  
PCR Backward Primer
TTATCCACTTCCAATGTTAACGCAAGGCCCACCATT  
Shipped To Lab
ANL  
Shipped Date
Oct 09, 2008  
Inserted
Oct 13, 2008