Clone

Target
IDP04670  
Clone Suffix
6
Experiment Start Date
May 28, 2013  
Experiment End Date
May 28, 2013  
Person
Brian Bishop  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG28  
Sequence Start
169  
Sequence End
401  
Reference Sequence Used
MQTQVRLQNE LMNAEKFHLI GEMAASISHE IRNPLTSTKG FLQLLQSDTC TEQERKLYID IAINGIEQAN HVLTDYLTFA KPSIEKEQRL QLEEELLHAL SLITPLANLT NVRTHYIKQS TSFFIAGEKQ KLNQCLLNIL KNCIEAMPKG GDLYFTLVPD HKHIQLYIKD TGVGMDQEQV KRLGSPFYST KEKGTGLGMM VVFSVVQAMN GKIDIISEKG TGTTFLLTFP LIQK  
Reference Sequence Variance
MATCH  
PCR Forward Primer
GTCTCTCCCATGCAAACTCAAGTTCGACTC  
PCR Backward Primer
GGTTCTCCCCAGCTTTTTGTATGAGTGGAAAAGTTAA