Clone

Target
IDP04686  
Clone Suffix
6
Experiment Start Date
May 28, 2013  
Experiment End Date
May 28, 2013  
Person
Brian Bishop  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG28  
Sequence Start
188  
Sequence End
423  
Reference Sequence Used
MTEYLNENAI LRTEMQKSEK LNIVSELAAS VAHEVRNPLT VVRGFIQLLE STEDVKNKDY MRLVLAELDR AEQIISDYLN LARPQIEKKE HICLSAQLIE MTTLMSSFAA MQGVYLQVEI SESLYTIGDK TKLKQAIMNV VKNGIEAIQG NKGYLKVTAM QKDETIVIRV KDSGVGMTKE QLARLGQPYY SLKEKGTGLG LMVTFSILQA HNGTLEYKSE SGKGTEAIII LPAVRNK  
Reference Sequence Variance
MATCH  
PCR Forward Primer
GTCTCTCCCATGACAGAATATTTAAATGAAAATG  
PCR Backward Primer
GGTTCTCCCCAGCCTTATTTCTTACAGCTGGTAATA