Clone

Target
IDP00891  
Clone Suffix
1
Experiment Start Date
Sep 08, 2008  
Experiment End Date
Sep 09, 2008  
Person
Jason Stam  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
70  
Reference Sequence Used
MSPAFSSWSD FFAMGGYAFF VWLAVAMTVA PLALLALHTV LQRRAILRGV AQQRAREARM RAAQAQQEAA  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGAGTCCGGCATTTTCATCG  
PCR Backward Primer
TTATCCACTTCCAATGTCACGCGGCCTCCTGTTG