Clone

Target
IDP91572  
Clone Suffix
700
Experiment Start Date
Jun 25, 2013  
Experiment End Date
 
Person
Rosa Di  
Lab
University of Calgary  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
pET28-SBP-TEV  
Sequence Start
1  
Sequence End
93  
Reference Sequence Used
 
PCR Forward Primer
TTGTATTTCCAGGGCATGCCTGTAGATTTAACGCCTTATA  
PCR Backward Primer
CAAGCTTCGTCATCATTCACGGCTTGTCAAACTACC