Clone

Target
IDP91790  
Clone Suffix
206
Experiment Start Date
Aug 30, 2011  
Experiment End Date
 
Person
Rosa Di  
Lab
University of Calgary  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
p15Tv lic  
Sequence Start
1  
Sequence End
301  
Reference Sequence Used
 
PCR Forward Primer
TTGTATTTCCAGGGCATGAGAGTATTCAACAAAGTTGTTG  
PCR Backward Primer
CAAGCTTCGTCATCAAGGTAAAGCTGTACCGCCAAG