Clone

Target
IDP91817  
Clone Suffix
412
Experiment Start Date
Dec 13, 2012  
Experiment End Date
Jan 17, 2013  
Person
Jeff Jiapeng  
Lab
Northwestern University  
Protocol ID
NU_default_cloning  
Status
success  
Vector
MCSG7  
Sequence Start
128  
Sequence End
216  
Reference Sequence Used
MNNMNVIIAD DHPIVLFGIR KSLEQIEWVN VVGEFEDSTA LINNLPKLDA HVLITDLSMP GDKYGDGITL IKYIKRHFPS LSIIVLTMNN NPAILSAVLD LDIEGIVLKQ GAPTDLPKAL AALQKGKKFT PESVSRLLEK ISAGGYGDKR LSPKESEVLR LFAEGFLVTE IAKKLNRSIK TISSQKKSAM MKLGVENDIA LLNYLSSVTL SPADKD  
PCR Forward Primer
91817IFhNF;AAGGAGATATACATATGCACCATCATCACCACCATAACAACATGAACGTTATTATCGCAGATGAC;69/55/65nt  
PCR Backward Primer
91817IFhNtevBioR;AAGTACAGGTTCTCGGTACCTTACTCATGCCACTCAATCTTCTGAG;67/56/46nt