Clone

Target
IDP06556  
Clone Suffix
108
Sequence Comments
IDP06556.53-271.P(278)..pMCSG68  
Experiment Start Date
May 15, 2015  
Experiment End Date
May 26, 2015  
Person
Michael Endres  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG68  
Sequence Start
53  
Sequence End
271  
Reference Sequence Used
SETGRDELEF TQLGEGVWMH TSWKDVPPWG PVMSNGLIVA DGEGSFLIDT AWNDEQTAAI LDWAERELGR PVRGAVFTHA HEDKMGGVGT VRARGIRTYA LALSNQLAAE GGVMPAEASL RLEAGGEPQT LGPVQVFYPG GGHTRDNIVV AVDGGVLFGG CLIRPGGTNS LGNTADADLD HWDEAVSAVA KRFPDRSVVI PSHGPPGGRE LLDQTIQLV  
PCR Forward Primer
TACTTCCAATCCAATGCCAGCGAAACCGGCCGCGAC  
PCR Backward Primer
TTATCCACTTCCAATGTTAGACGAGTTGGATCGTCTGGTC  
Shipped To Lab
ANL  
Shipped Date
May 26, 2015  
Inserted
Nov 04, 2014