Clone

Target
IDP06556  
Clone Suffix
109
Sequence Comments
IDP06556.56-273.P(278)..pMCSG68  
Experiment Start Date
May 15, 2015  
Experiment End Date
May 26, 2015  
Person
Michael Endres  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG68  
Sequence Start
56  
Sequence End
273  
Reference Sequence Used
GRDELEFTQL GEGVWMHTSW KDVPPWGPVM SNGLIVADGE GSFLIDTAWN DEQTAAILDW AERELGRPVR GAVFTHAHED KMGGVGTVRA RGIRTYALAL SNQLAAEGGV MPAEASLRLE AGGEPQTLGP VQVFYPGGGH TRDNIVVAVD GGVLFGGCLI RPGGTNSLGN TADADLDHWD EAVSAVAKRF PDRSVVIPSH GPPGGRELLD QTIQLVQS  
PCR Forward Primer
TACTTCCAATCCAATGCCGGCCGCGACGAGCTCGA  
PCR Backward Primer
TTATCCACTTCCAATGTTACGACTGGACGAGTTGGATCGT  
Shipped To Lab
ANL  
Shipped Date
May 27, 2015  
Inserted
Nov 04, 2014