Clone

Target
IDP06560  
Clone Suffix
104
Sequence Comments
IDP06560.35-261.P(262)..pMCSG68  
Experiment Start Date
May 15, 2015  
Experiment End Date
May 26, 2015  
Person
Michael Endres  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG68  
Sequence Start
35  
Sequence End
261  
Reference Sequence Used
QPKDVPVTFT AITQGVWMHT SMKHMENWGH VPSNGLIVEK GDFSILVDTA WDDPQTAQII EWSKDTLKKP IRWAVFTHAH DDKMGGVAAL RQQGIVTYAA ADSNRMAPQN GLTPAEHDLI FDSEHSTSVL HPLVIFDPGP GHTRDNIVVG LPEQGIVFGG CLIRPSGSTS LGNTADADLA HWKTAVLAVA QRFAEAQQII PSHGPMAGRE LFELTAQLAE KASIPST  
PCR Forward Primer
TACTTCCAATCCAATGCCCAACCGAAAGATGTCCCGGTGA  
PCR Backward Primer
TTATCCACTTCCAATGTTACGTGCTCGGGATGCTCGCTTT  
Shipped To Lab
ANL  
Shipped Date
May 26, 2015  
Inserted
Nov 04, 2014