flash(); ?>

Clone

Target
IDP06554  
Clone Suffix
132
Sequence Comments
IDP06554.30-245.P(268)..pMCSG73  
Experiment Start Date
May 15, 2015  
Experiment End Date
May 26, 2015  
Person
Michael Endres  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG73  
Sequence Start
30  
Sequence End
245  
Reference Sequence Used
NKSDAEVKEP RKTSPDLKPV EIKELGDGVW IHTSYKIVMP WGNVLTNGLI IERGNHTVLI DTAWNDEQTA EILDWAEITL KKPVQASIHT HAHSDKMGGM KALHSRGVVT YASKLTNKLA LERGLDQAQS QLDLSEIGDQ IEWNGLSVLY PGGGHSEDNI VVNDFTTRIL FGGCMIRPGM TKSLGNTGDA NLKYWSKAVE NAANAFPNSN IVVPSH  
PCR Forward Primer
TACTTCCAATCCAATGCCAACAAATCAGATGCGGAAGTGAAAGAAC  
PCR Backward Primer
TTATCCACTTCCAATGTTAGTGGGACGGGACAACGATATTACT  
Shipped To Lab
ANL  
Shipped Date
May 26, 2015  
Inserted
Nov 04, 2014