flash(); ?>

Clone

Target
IDP00119  
Clone Suffix
200
Experiment Start Date
Oct 10, 2007  
Experiment End Date
 
Person
Olena Onopriyenko  
Lab
University of Calgary  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
p15Tv lic  
Sequence Start
1  
Sequence End
302  
Reference Sequence Used
MISASLQQRK TRTRRSMLFV PGANAAMVSN SFIYPADALM FDLEDSVALR EKDAARRLVY HALQHPLYRD VETIVRVNAL DSEWGVNDLE AVVRGGADVV RLPKTDTAQD VIDIENEILR IENACGREPG STGLLAAVES PLGITRAVEI AHASERLIGI ALGAEDYVRN LRTERSPEGT ELLFARCAIL QAARSAGIQA FDTVYSDANN EAGFLQEAAH IKQLGFDGKS LINPRQIELL HNLYAPTRKE VAHARLVVEA AEAAAREGLG VVSLNGKMVD SPVIERARLV LSRAELSGIR EE  
PCR Forward Primer
TTGTATTTCCAGGGCATGATTTCCGCCTCTCTGCAAC  
PCR Backward Primer
CAAGCTTCGTCATCATTCTTCGCGAATACCGGAAAG