flash(); ?>

Clone

Target
IDP00942  
Clone Suffix
201
Experiment Start Date
Oct 10, 2007  
Experiment End Date
 
Person
Olena Onopriyenko  
Lab
University of Calgary  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
p15Tv lic  
Sequence Start
1  
Sequence End
387  
Reference Sequence Used
MKSIEKDKYQ DIRDAVRSLC SEFDDKYHRK IDEAKAYPEE FVNKLTKAGW LAALIPEEFG GSGLGLTEAS IIMEEINRSG GNSGACHGQM YNMNTLLRHG SDKQKEFWLP RIATGEWRLQ SMGVTEPTAG TDTTRIKTTA VKREDRYVIN GQKVWISRVQ HSDWMILLVR TTPLANVKRK SEGMSIFMVD IKEAMKNGMT VRPIPNMVNH ETNELFFDNL EIPEENLIGE EGMGFHYILD GLNAERTLIA AECIGDGYWF MDRVTRYTCE REVFGRPIGQ NQGVQFPIAE AFIAVEAANL MRFKACELFD QHLDCGAQAN MAKYLAAKAS WEAANACLQF HGGYGFACEY DIERKFRETR LYQVAPISTN LILSYIAEHV LEMPRSF  
PCR Forward Primer
TTGTATTTCCAGGGCATGAAAAGTATTGAAAAGGATAAATATCA  
PCR Backward Primer
CAAGCTTCGTCATCAGAATGAACGTGGCATCTCCAG