flash(); ?>

Clone

Target
IDP01020  
Clone Suffix
201
Experiment Start Date
Oct 10, 2007  
Experiment End Date
 
Person
Olena Onopriyenko  
Lab
University of Calgary  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
p15Tv lic  
Sequence Start
1  
Sequence End
184  
Reference Sequence Used
MQDLSGFTVP KGFRGANALK VQLWWAVQAT LFAGSPQILY RWRAFLLRLF GAKIGKNVVI RPSVKITYPW KLTVGDYAWV GDDAVLYTLG EINIGAHAVI SQKGYLCTGS HDYTSAHFDI NAAPIVIGEK CWLATDVFVA PGVTIGHGTV VGARSSVFKS LPANAICRGN PAVVTRQRVQ KVTP  
PCR Forward Primer
TTGTATTTCCAGGGCATGCAGGATCTTAGCGGCTTTACGGT  
PCR Backward Primer
CAAGCTTCGTCATCAGGGAGTAACTTTCTGAACGC