Clone

Target
CPX_06552_06553  
Clone Suffix
106
Sequence Comments
CPX_06552_06553.1-410.F..pMCSG73  
Experiment Start Date
Sep 08, 2014  
Experiment End Date
Sep 09, 2014  
Person
Shonda Clancy  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
failed  
Vector
pMCSG73  
Sequence Start
 
Sequence End
 
Reference Sequence Used
 
PCR Forward Primer
TACTTCCAATCCAATGCCATGAGTGCTGCCATCGCCGAA  
PCR Backward Primer
TTATCCACTTCCAATGTTATGCGGACATCCCTAGTCGTAC  
Shipped To Lab
ANL  
Shipped Date
Sep 09, 2014  
Inserted
Jul 26, 2016