Clone

Target
CPX_04043_05684  
Clone Suffix
102
Sequence Comments
CPX_04043_05684.1-288.F..pMCSG68  
Experiment Start Date
Oct 10, 2017  
Experiment End Date
Oct 10, 2017  
Person
Michael Endres  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
failed  
Vector
pMCSG68  
Sequence Start
 
Sequence End
 
Reference Sequence Used
 
PCR Forward Primer
TACTTCCAATCCAATGCCGATTCGCTTCCTGAGCGCATC  
PCR Backward Primer
TTATCCACTTCCAATGTTATTTCTCAACTAGTCTTACAGTTAGTATGAATGAA  
Shipped To Lab
ANL  
Shipped Date
Oct 10, 2017  
Inserted
Feb 08, 2018