Clone

Target
IDP02185  
Clone Suffix
1
Experiment Start Date
Jan 28, 2009  
Experiment End Date
Jan 29, 2009  
Person
Jason Stam  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
failed  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
127  
Reference Sequence Used
MSNIPKELKY TKSHEWVKID GDEVTVGITA HAQSLLGDLV YVELPEIGKE FAAGDDSCVV ESVKAASDVY APVDGEVIEI NEALVDDPSR VNHTPYKDGW LFKLKISDES QLADLLTADA YAKTLED  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGTCAAATATTCCTAAAGAATTAA  
PCR Backward Primer
TTATCCACTTCCAATGTTAATCCTCAAGAGTTTTTGCAT