Clone

Target
CPX_97280_97345  
Clone Suffix
105
Sequence Comments
CPX_97280_97345.1-106.F..pMCSG92  
Experiment Start Date
Dec 10, 2018  
Experiment End Date
Dec 10, 2018  
Person
Michael Endres  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
failed  
Vector
pMCSG92  
Sequence Start
 
Sequence End
 
Reference Sequence Used
 
PCR Forward Primer
AGGAGGTTAGATATGGGTATCAAATTTTCCTCTAAGCGCC  
PCR Backward Primer
TTGGAAGTAGAGGTTCTCGAGCTTCCTTTCCTTCTGGCTTG  
Shipped To Lab
ANL  
Shipped Date
Dec 10, 2018  
Inserted
Dec 11, 2018