flash(); ?>

Clone

Target
IDP97423  
Clone Suffix
102
Sequence Comments
IDP97423.1-550.F..pMCSG53  
Experiment Start Date
Mar 01, 2019  
Experiment End Date
Mar 01, 2019  
Person
Michael Endres  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG53  
Sequence Start
1  
Sequence End
550  
Reference Sequence Used
MTPADLAELL KATAAAVLAE RGLDASALPQ MVTVERPRIP EHGDYASNLA MQLAKKVGTN PRELAGWLAE ALTKVDGIAS AEVAGPGFIN MRLETAAQAK VVTSVIDAGH SYGHSLLLAG RKVNLEFVSA NPTGPIHIGG TRWAAVGDAL GRLLTTQGAD VVREYYFNDH GAQIDRFANS LIAAAKGEPT PQDGYAGSYI TNIAEQVLQK APDALSLPDA ELRETFRAIG VDLMFDHIKQ SLHEFGTDFD VYTHEDSMHT GGRVENAIAR LRETGNIYEK DGATWLRTSA FGDDKDRVVI KSDGKPAYIA GDLAYYLDKR QRGFDLCIYM LGADHHGYIA RLKAAAAAFG DDPATVEVLI GQMVNLVRDG QPVRMSKRAG TVLTLDDLVE AIGVDAARYS LIRSSVDTAI DIDLALWSSA SNENPVYYVQ YAHARLSALA RNAAELALIP DTNHLELLNH DKEGTLLRTL GEFPRVLETA ASLREPHRVC RYLEDLAGDY HRFYDSCRVL PQGDEQPTDL HTARLALCQA TRQVIANGLA IIGVTAPERM  
PCR Forward Primer
TACTTCCAATCCAATGCCGTGACCCCCGCTGACCTG  
PCR Backward Primer
TTATCCACTTCCAATGTTACATTCGCTCCGGTGCGGTGA  
Shipped To Lab
ANL  
Shipped Date
Feb 28, 2019  
Inserted
Mar 01, 2019