flash(); ?>

Clone

Target
IDP97692  
Clone Suffix
103
Sequence Comments
IDP97692.11-361.P(420)..pMCSG53  
Experiment Start Date
Mar 07, 2019  
Experiment End Date
Mar 07, 2019  
Person
Michael Endres  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG53  
Sequence Start
11  
Sequence End
361  
Reference Sequence Used
VGLEIGTAKV AALVGEVLPD GMVNIIGVGS CPSRGMDKGG VNDLESVVKC VQRAIDQAEL MADCQISSVY LALSGKHISC QNEIGMVPIS EEEVTQEDVE NVVHTAKSVR VRDEHRVLHV IPQEYAIDYQ EGIKNPVGLS GVRMQAKVHL ITCHNDMAKN IVKAVERCGL KVDQLIFAGL ASSYSVLTED ERELGVCVVD IGGGTMDIAV YTGGALRHTK VIPYAGNVVT SDIAYAFGTP PSDAEAIKVR HGCALGSIVG KDESVEVPSV GGRPPRSLQR QTLAEVIEPR YTELLNLVNE EILQLQEKLR QQGVKHHLAA GIVLTGGAAQ IEGLAACAQR VFHTQVRIGA P  
PCR Forward Primer
TACTTCCAATCCAATGCCGTAGGACTGGAAATTGGTACCGC  
PCR Backward Primer
TTATCCACTTCCAATGTTACGGCGCGCCGATACGCA  
Shipped To Lab
ANL  
Shipped Date
Mar 07, 2019  
Inserted
Mar 08, 2019