Clone

Target
IDP01381  
Clone Suffix
2
Experiment Start Date
Jun 06, 2008  
Experiment End Date
Jun 07, 2008  
Person
Jason Stam  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
failed  
Vector
pMCSG19c  
Sequence Start
1  
Sequence End
158  
Reference Sequence Used
MIRIGHGFDV HRFGGEGPII IGGVKIPYEQ GLIAHSDGDV ALHALSDALL GAIAAGDIGR HFPDTDDKWK GADSRELLKD VYRRVKAQGY VLGNADVTII AQAPKMAPYI QAMCAAIAED LETDLGNINV KATTTEKLGF TGRKEGIACE AVVLLRKA  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGATCAGAATTGGCCACGG  
PCR Backward Primer
TTATCCACTTCCAATGTTAAGCTTTGCGCAAAAGTACA