Clone

Target
IDP90247  
Clone Suffix
104
Sequence Comments
IDP90247.1-389.F..pMCSG68  
Experiment Start Date
May 01, 2020  
Experiment End Date
May 02, 2020  
Person
Robert Jedrzejczak  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG68  
Sequence Start
1  
Sequence End
389  
Reference Sequence Used
MKMKLPPFIE LYRALIATPS ISAADSALDQ SNEALINLLA GWFADLGFRV EIQPVPDTRH KFNLLASIGE NENGEGHGGL LLAGHTDTVP YDEGRWTRDP FTLTEHDHKL YGLGTADMKG FFAFILDAVR DIDASKLTKP LYILATADEE TTMAGARYFA ANTQLRPDFA IIGEPTSLQP VRAHKGHISN AIRITGQSGH SSDPARGVNA IDLMHESITQ LMALRTTLQE RYHNPAFTIP YPTMNFGHIN GGDAANRICA CCELHMDIRP LPGLTLSDLN ELMTEALEPV SQRWPGRLSI DELHPPIPGY ECPTDHHMVG VIEKLLGERT AVVNYCTEAP FIQQVCPTLV LGPGSINQAH QPDEFIDMAF IEPTRELIGQ LVDHFCQQK  
PCR Forward Primer
TACTTCCAATCCAATGCCGTGAAGATGAAATTACCTCCATTTATTGAGCT  
PCR Backward Primer
TTATCCACTTCCAATGTTATTTCTGCTGGCAAAAGTGGTCAACTAG  
Shipped To Lab
ANL  
Shipped Date
Feb 03, 2021  
Inserted
Feb 08, 2021