Clone

Target
IDP90248  
Clone Suffix
104
Sequence Comments
IDP90248.1-426.F..pMCSG68  
Experiment Start Date
May 01, 2020  
Experiment End Date
May 02, 2020  
Person
Robert Jedrzejczak  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG68  
Sequence Start
1  
Sequence End
426  
Reference Sequence Used
MNEEVSQLLE QIDLRKDELL ELTKTLIRFE TPAPPARNTN EAQEFVAEFL RKRNFSVDKW DVYPNDPNVV GVKKGTESDT HKSLIINGHM DVAEVSADEA WETNPFEPFI KDGWLVGRGA ADMKGGLAGA LFAIQLLQEA GIELPGDVIF QSVIGEEVGE AGTLQCCKRG YDADFAVVVD TSDLHMQGQG GVITGWITVK SPQTFHDATR RQMIHAGGRL FGASAIEKMM KIVQSLQELE RHWAVMKTYE GYPSGTTTIN PAVIEGGRHA AFIADECRLW ITVHFYPNET HEQIIKEIEE YIGKVAAADP WLSENPPQFK WGGESMIVDR GEIFPSLEID SEHAAVKTLS SVHESILSKN AILDMSATVT DGGWFSEFHI PAVIYGPGTL EEAHSINEKV EIEQLIEFTK VITAFIYEWC HTKKID  
PCR Forward Primer
TACTTCCAATCCAATGCCATGAATGAAGAAGTTTCACAGCTATTAGAACAAATT  
PCR Backward Primer
TTATCCACTTCCAATGTTAATCTATTTTTTTCGTATGACACCATTCGTATATAAATG  
Shipped To Lab
ANL  
Shipped Date
Feb 03, 2021  
Inserted
Feb 08, 2021