Clone

Target
IDP90249  
Clone Suffix
102
Sequence Comments
IDP90249.1-378.F..pMCSG68  
Experiment Start Date
May 01, 2020  
Experiment End Date
May 02, 2020  
Person
Robert Jedrzejczak  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG68  
Sequence Start
1  
Sequence End
378  
Reference Sequence Used
MPLPSFLEVY EGLISTSSIS STDARWDEGN EQVIAKLADW LSALGFSIQI EQVAPNKQNL IAKLGSGEGG LLLAGHSDTV PFDEGRWNYN PHALTQVNNR FYGLGTADMK GFFAFIYEAV KNVDWSKQTK PLYVLATCDE ETTMLGARHF TENAPFKPDY CIIGEPTSLV PIRAHKGHVA NAIRVTGKSG HSSNPALGVN AIEIMHEVLF ALMQLRDRLI KEYHHPGFEI PTPTLNLGHI HGGDSPNRIC GCCELHYDVR PLPGISLDGL DNLMHDALRE VQQKWPGRIE LVPLHDPIPG YECAHDHPFI HGISEICEQE AQTVNYCTEA PFLQQVCPTL VLGPGSIDQA HQPDEFLAFE FIDPTVRVLS RAMQKYCF  
PCR Forward Primer
TACTTCCAATCCAATGCCATGCCGTTACCCAGTTTCCTTGAG  
PCR Backward Primer
TTATCCACTTCCAATGTTAGAAACAATATTTCTGCATGGCTCGTGATA  
Shipped To Lab
ANL  
Shipped Date
Feb 03, 2021  
Inserted
Feb 08, 2021