Clone

Target
IDP52003  
Clone Suffix
656
Sequence Comments
IDP52003.746-1060.P(1945).C856A,D1031A.pMCSG53  
Experiment Start Date
Jun 02, 2021  
Experiment End Date
Jun 02, 2021  
Person
Michael Endres  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
failed  
Vector
pMCSG53  
Sequence Start
746  
Sequence End
1060  
Reference Sequence Used
EVRTIKVFTT VDNINLHTQV VDMSMTYGQQ FGPTYLDGAD VTKIKPHNSH EGKTFYVLPN DDTLRVEAFE YYHTTDPSFL GRYMSALNHT KKWKYPQVNG LTSIKWADNN CYLATALLTL QQIELKFNPP ALQDAYYRAR AGEAANFCAL ILAYCNKTVG ELGDVRETMS YLFQHANLDS CKRVLNVVCK TCGQQQTTLK GVEAVMYMGT LSYEQFKKGV QIPCTCGKQA TKYLVQQESP FVMMSAPPAQ YELKHGTFTC ASEYTGNYQC GHYKHITSKE TLYCIDGALL TKSSEYKGPI TDVFYKENSY TTTIK  
PCR Forward Primer
TACTTCCAATCCAATGCCGAAGTGAGGACTATTAAGGTGTTTACAACA  
PCR Backward Primer
TTATCCACTTCCAATGTTATTTTATGGTTGTTGTGTAACTGTTTTCTTTGTAGAAAA  
Shipped To Lab
ANL  
Shipped Date
Jun 02, 2021  
Inserted
Jun 07, 2021