Clone

Target
IDP00253  
Clone Suffix
1
Experiment Start Date
Jul 22, 2009  
Experiment End Date
Jul 24, 2009  
Person
Sarah Grimshaw  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
failed  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
400  
Reference Sequence Used
MAHCIGITDR DFIEGVHGGT WVSATLEQDK CVTVMAPDKP SLDISLETVA IDRPAEVRKV CYNAVLTHVK INDKCPSTGE AHLAEENEGD NACKRTYSDR GWGNGCGLFG KGSIVACAKF TCAKSMSLFE VDQTKIQYVI RAQLHVGAKQ ENWNTDIKTL KFDALSGSQE VEFIGYGKAT LECQVQTAVD FGNSYIAEME TESWIVDRQW AQDLTLPWQS GSGGVWREMH HLVEFEPPHA ATIRVLALGN QEGSLKTALT GAMRVTKDTN DNNLYKLHGG HVSCRVKLSA LTLKGTSYKI CTDKMFFVKN PTDTGHGTVV MQVKVSKGAP CRIPVIVADD LTAAINKGIL VTVNPIASTN DDEVLIEVNP PFGDSYIIVG RGDSRLTYQW HKEGSSIGKL F  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGGCTCACTGCATTGGAATT  
PCR Backward Primer
TTATCCACTTCCAATGGAACAACTTTCCTATTGAGCTT