Clone

Target
IDP00026  
Clone Suffix
3 - The clone is available in BEIR and it is in stock.
Experiment Start Date
Apr 15, 2010  
Experiment End Date
Apr 15, 2010  
Person
Jason Stam  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
198  
Reference Sequence Used
MPIILEKGQK IDLTKGQPKV AKLQVGLGWD PIGQSGGFLS SLFGSKPNVD CDASVVMLEG DRFLNKNDLV YFGNKLSTCG SIIHSGDNLT GEGAGDDETI FVELHKVPSR INRLVFVVNI YDCVNRRQDF GMIRNAYIRI QNPQTGEELA RYNLSDNYAG KTTLIAGEMY RHGSEWKFSA VGEGTQDKNL SEIVSRYQ  
Reference Sequence Variance
MATCH  
Confirmed Protein Sequence
MPIILEKGQK IDLTKGQPKV AKLQVGLGWD PIGQSGGFLS SLFGSKPNVD CDASVVMLEG DRFLNKNDLV YFGNKLSTCG SIIHSGDNLT GEGAGDDETI FVELHKVPSR INRLVFVVNI YDCVNRRQDF GMIRNAYIRI QNPQTGEELA RYNLSDNYAG KTTLIAGEMY RHGSEWKFSA VGEGTQDKNL SEIVSRYQ  
PCR Forward Primer
TACTTCCAATCCAATGCGATGCCTATTATTTTAGAAAAAGGT  
PCR Backward Primer
TTATCCACTTCCAATGTTATTGATAACGTGATACAATCTC  
Shipped To Lab
ANL  
Shipped Date
Apr 29, 2010  
Secondary Shipped To Lab
UT  
Secondary Shipped Date
Sep 19, 2011  
Inserted
May 03, 2010