Clone

Target
IDP00747  
Clone Suffix
1
Experiment Start Date
Jun 06, 2008  
Experiment End Date
Jun 07, 2008  
Person
Jason Stam  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
154  
Reference Sequence Used
MTTINPTNYT LLKKQAASLI EDEHHMIAIL SNMSALLNDN LDQINWVGFY LLEQNELILG PFQGHPACVH IPIGKGVCGT AVSERRTQIV ADVHQFEGHI ACDANSKSEI VVPIFKDDKI IGVLDIDAPI TDRFDDNDKE HLEAIVKIIE KQLA  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGACAACAATTAACCCAACAAA  
PCR Backward Primer
TTATCCACTTCCAATGTTATGCGAGTTGCTTTTCAATAA