Clone

Target
IDP90360  
Clone Suffix
200 - The clone is available in BEIR and it is in stock.
Experiment Start Date
Jan 16, 2008  
Experiment End Date
 
Person
Rosa Di  
Lab
University of Calgary  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
p15Tv lic  
Sequence Start
1  
Sequence End
242  
Reference Sequence Used
MKVKINDQFI CISPYISARW NQIAFIESCD GGTEGGITLK LHLIDGETVS IPNLGQAIVD EVFQEHLLYL ESTAPQKNKE EEKISSLLGA VQQMAKGCEV QVFSQKGLVS MLLGGAGSIN VLLQHSPEHK DHPDLPTDLL ERIAQMMRSL SIGPTSILAK PEPHCNCLHC QIGRATVEEE DAGVSDEDLT FRSWDISQSG EKMYTVTDPL NPEEQFNVYL GTPIGCTCGQ PYCEHVKAVL YT  
PCR Forward Primer
TTGTATTTCCAGGGCATGAAAGTTAAAATTAATGATCAGTTC  
PCR Backward Primer
CAAGCTTCGTCATCAAGTATAAAGAACAGCTTTCACG