Clone

Target
IDP90375  
Clone Suffix
200 - The clone is available in BEIR and it is in stock.
Experiment Start Date
Jan 16, 2008  
Experiment End Date
 
Person
Rosa Di  
Lab
University of Calgary  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
p15Tv lic  
Sequence Start
1  
Sequence End
155  
Reference Sequence Used
MRAVLHLEHK RYFQNHGHIL FEGLAPVSDC KQLEAELKLF LKEVAVVKDR HLQRWRENVH RTLPEVQMIV KRVRLDHLAA ELTHRSRVAL VRDLWVQKQE EIFFDDCDCS VLLCLSGEKA GWGLFFSGEY PQDVFNWGAG DTAIILRFSS AGFPN  
PCR Forward Primer
TTGTATTTCCAGGGCATGAGGGCAGTTTTACACCTAG  
PCR Backward Primer
CAAGCTTCGTCATCAGTTAGGAAATCCCGCTGAGG