Clone

Target
IDP90392  
Clone Suffix
200 - The clone is available in BEIR and it is in stock.
Experiment Start Date
Jan 16, 2008  
Experiment End Date
 
Person
Rosa Di  
Lab
University of Calgary  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
p15Tv lic  
Sequence Start
1  
Sequence End
183  
Reference Sequence Used
MTTKPKTLEI DNNTFLLLEG NLKRIFATPI GYTTFREFQN VVFNCAQGQQ ELANFLFEML INGKLLQELP AGQKQSAQSL IVQFMMPIRV AKDIHERGEF INFITSDMLA QQERCVFLNR LSRVDGQEFL LMTDVQNTCH LIRHLLSRLL EAQKNPIGEK NLQEIQEDLD SLRAHFEELT KSV  
PCR Forward Primer
TTGTATTTCCAGGGCATGACGACGAAACCCAAAACTC  
PCR Backward Primer
CAAGCTTCGTCATCACACAGATTTCGTTAATTCTTCAAAG