Clone

Target
IDP05547  
Clone Suffix
1
Experiment Start Date
Nov 06, 2010  
Experiment End Date
Nov 08, 2010  
Person
Sarah Grimshaw  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
failed  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
273  
Reference Sequence Used
MKKLTKGLGI LLASSLVLGL AACGGGSDDK ALSTEKITIG TTAGPHQQIA EEVQKLAKKD GLEIKIKTFD DYNTPNTALN DGDLDANNYQ TIPFLEQQKK DKGYKLDVAF KTVAFPMGIY SNDIKDLKNL KKGDKIAVPN DPSNEYRGLK LFEDAGVIKL KDGVEEKATK KDIAENPLDL EIVELEASQI PAQLDEVAAA AINTNFAMGA GLSINKDAIY HEPTKDNPYP NVFVVRSANK DDEVVKTLEK YYHSDEVKAF IEKEFNGSVV PAF  
Reference Sequence Variance
MATCH  
PCR Forward Primer
TACTTCCAATCCAATGCGATGAAAAAATTAACAAAAGGGTTAG  
PCR Backward Primer
TTATCCACTTCCAATGCTAGAATGCAGGTACTACAGA