Clone

Target
IDP02008  
Clone Suffix
226
Experiment Start Date
Mar 15, 2011  
Experiment End Date
 
Person
Veronica Yim  
Lab
University of Calgary  
Protocol ID
20  
Status
success  
Vector
pET21b-L No TEV  
Sequence Start
76  
Sequence End
317  
Reference Sequence Used
QNSIQADNAW LQASGYDFHT TENQQMGITL LSAFNTLPEA VLKDNLATVT AINHDADVNT RHQALADAES VEYLYFLSDA MGPRLGRAFL AAYDKGELGK AAALIKASEV STGAAKKYFH YPRPYQVPGN TIHLTPDDVV VKDGHPYTAG GGAFPSGHTN TGYTDALLMA EMIPERFDAL VIRGARYGYS RLVLGVHYPL DVMGARMVAQ RNVAHYLNDP YYRTLFNEAR AQLREALVKE CG  
PCR Forward Primer
GGAGATATACATATGCAGAATTCCATCCAGGCGG  
PCR Backward Primer
GTGGTGGTGCTCGAGACCGCACTCTTTCACCAGC